human biology - Is sperm contagious?

I'm unsure about the use of the word "contagious" here. If you would describe it as an organism "catching something" from another only once, this answer applies (vaguely perhaps).

One example of "contagious" sperm: sea urchins spray their sperm (called milt) into the surrounding water, so that it can hopefully fertilize roe, which are fish eggs. The eggs are also expulsed for some species, but for others they stay on the surface of the female sea urchin, as this Wikipedia article explains.

The gonads are lined with muscles underneath the peritoneum, and these allow the animal to squeeze its gametes through the duct and into the surrounding sea water where fertilization takes place.
...

In most cases, the eggs float freely in the sea, but some species hold onto them with their spines, affording them a greater degree of protection.

Thus, it's entirely possible for a female sea urchin to be bombarded by free-floating sperm, to ultimately fertilize the eggs on its surface. I don't know if one would strictly consider this a contagion, but it's what I initially thought of after reading the question.

---

When referring to sexually transmitted disease however, sperm in itself is not contagious, as it would require the pathogen to "tag along with it" in whichever environment (whether it be airborne or aquatic). Also, if considering impregnation as "contagious", physical contact would certainly be required.

In short: For humans, no. For sea urchins (and likely other aquatic animals), sort of.

human biology - Why do we like salt?

In developed countries we usually consume enough salt (sodium to be exact) without actually adding table salt to food. Everything can become toxic when consumed in excess - even water - and when we frequently add more salt to foods, we tend to consume sodium in potentially harmful excess. That's what your friends are referring to.

However, salt (sodium) is one of the most essential substances your body needs to stay alive, for several reasons. One of the main purposes of sodium is the upkeep of blood's osmolarity (i.e. concentrations of osmotically active compounds. Higher salt concentration on one side of a permeable membrane attracts water to that side - I'm sure you've heard that before). There are numerous systems in your body to make sure the osmolarity of blood is correct. If they fail and blood becomes hypo or hypertonic, your cells will be sucked dry or pumped full of water and in either case, burst and die.

Look up the renin-angiotensin-aldosterone system for example: when the kidney filters blood, it reabsorbs or lets through water depending on the current blood osmolarity; leading to higher or lower amount of higher or lower concentrated urine. You drink lots, your blood is diluted, it becomes less tonic, kidney registers that and lets water through more, you urinate more. There are many more elements involved there, including blood pressure, nerve signals stimulating thirst or hunger of different kinds, some hormones etc.

As you can see, there's a reason why the basic infusion given in hospitals to replace lost blood quickly isn't just water but normal saline.

Delayed update to pick up some side aspects of your description: 1) There are of course things that humans do which have absolutely no value to them whatsoever. Anything that plays into the feel-good-reward-circuit in our brain can become such an unhelpful habit. Take smoking and drug consumption as examples. 2) About evolutionary relevance: Being a key player in maintaining body function, evolution selected for instictively liking salt. Simultaneously, most people will not like food that is extremely salty - a protective mechanism against excess.

mars - How long would it take for earth's core to cool down and solidify?

At what rate is the earth's core cooling down?

The inner core is cooling at the rate of around $55^{circ} C$ every billion years.

Would earth go the same way as Mars by first losing its magnetic field followed by its atmosphere as its core solidifies and cools down ?

Given enough time, yes; But earth is constantly producing heat though multiple processes, the most important being the decay of radioactive elements with long half lives (for e.g., U-238 has a half life of around 4.5 billion years). As the present temperature of the inner core is estimated to be around $5000^{circ} C$, this is going to take tens of billions of years.

The magnetic fields are generated by eddy currents in the outer core, which is a liquid layer about 2,300 km thickness. The inner core is growing at the rate of about 1 mm per year, so it is going to 'freeze over' (i.e. solidify) in about 2.3 billion years. Without its liquid outer core, the Earth's magnetic field shuts down, and charged particles emanating from the Sun gradually deplete the atmosphere, like Mars.

Is it slow enough?

Well, it is not slow enough for the sun to become a red giant and fry earth, which will happen in 4 billion years or so. But is certainly doesn't matter as we won't be around to witness it.

heat - What Makes Stars Hot?

Stars do not get hot because of nuclear fusion, they become hot enough to sustain nuclear fusion and this process maintains their temperatures. Nuclear fusion actually stops a star getting hotter.

Protostars (before nuclear fusion) get hot because of a well known statistical relationship between the gravitational potential energy of a gas and the internal kinetic energy of the particles that make up the gas. [In an ideal gas, the kinetic energy of the particles is directly proportional to the temperature of the gas.] This is known as the virial theorem, which says that twice the summed kinetic energy of particles ($K$) plus the gravitational potential energy ($Omega$, which is a negative quantity for a bound object) equals zero.
$$ 2K + Omega = 0$$

Now you can write down the total energy of the system as
$$ E_{tot} = K + Omega$$
and hence from the virial theorem that
$$E_{tot} = frac{Omega}{2},$$
which is also negative.

If we now remove energy from the system, for instance by allowing the gas to radiate away energy, such that $Delta E_{tot}$ is negative, then we see that
$$Delta E_{tot} = frac{1}{2} Delta Omega$$

So $Omega$ becomes more negative - which is another way of saying that the protostar attains a more collapsed configuration.

Oddly, at the same time, we can use the virial theorem to see that
$$ Delta K = -frac{1}{2} Delta Omega = -Delta E_{tot}$$
is positive. i.e. the kinetic energies of particles in the gas (and hence their temperatures) actually become hotter. In other words, the gas has a negative heat capacity. But a hotter temperature usually means more radiation is produced and if the energy losses continue, then so does the collapse.

This process is ultimately arrested in a star by the onset of nuclear fusion. This replaces the radiative losses with nuclear energy and the star attains a quasi-equilibrium that lasts as long as it has nuclear fuel to burn.

evolution - What advantage would the initial 'donor' in horizontal gene transfer by conjugation have received?

I am struggling to think why horizontal gene transfer between bacteria would have persisted during the course of evolution as surely it puts the 'donor' at a disadvantage?

For example, consider a hypothetical situation where only one species of bacteria has a gene to resist a new (almost) omnipotent antibiotic. When growing on this medium, this species of bacteria has nil inter-specific competition for the resources it needs. Yet if it passes on the plasmid containing the resistance gene via conjugation to individuals of a different bacterial species, they then too are able to grow on the medium and potentially out-compete the first species - thus the conjugation could possibly be extremely detrimental to the survival of the original population.

I'm obviously missing something as the feature has persisted, so what is the advantage to the donor species of conjugation?

Are there any studies that prove/disprove the Oscillating Universe Theory?

The evidence suggests, strongly, that the expansion of the universe is accelerating. If an oscillating universe theory ruled that out then this would, in turn, dismiss this theory. As it is, it does strongly indicate that the idea that gravitational attraction would eventually slow the expansion of the universe and then send the expansion into reverse, is a false one.

But, you really need to be more specific in your question: which theory of an oscillating universe is it that you are asking about?

bioinformatics - What is the optimal frame size for protein secondary structure prediction methods?

The whole question is

What is the optimal frame size for the second and third generation protein secondary structure prediction methods? Justify your answer.

I remember it has something to do with the average length of alpha-helix. More specifically, 3 on both side of a site. So in total the frame length should be 7. But I can't remember the reason behind the argument.

What do you think?

---

According to what my professor said in class, 2nd and 3rd generation of protein secondary structure reconstruction relies on statistics data of several consecutive residues. I guess what he meant by "frame size", is how many adjacent residues we should take into account in the algorithm.

Absolute/apparent magnitude and distance for HIP31978 inconsistent?

EDIT: I am still following up, but here's the latest response from Wolfram:

Paclet servers are updated and optimized for each version of
Mathematica, so I suspect you may be working on an older version which
we no longer update. Many times we get reports that data from the
paclet data for version 9 was incorrect, only to find that it has
already been fixed for version 10.

According to Mathematica and several other sources, the
known information about HIP31978 (also known as "S
Monocerotis" and "15 Monocerotis") includes:

• The star system is about 101.06 light years from our own.




• The star's absolute magnitude is -2.79 (some sources say even lower).




• The star's visual magnitude from our solar system is 4.66.

The star is slightly variable, but not enough to explain
the following discrepancy:

If the star's magnitude at 32.6 light years is -2.79
(definition of absolute magnitude), it would be about 9.6
times fainter at 101.06 light years (it's actual distance
from us). However, that's only about 2.5 magnitudes
fainter, nowhere near enough to bring it down to magnitude
4.66.

What's happening here, and is this a one-off special case,
or does this happen a lot?

For reference, my calculation of the apparent magnitude:

-2.79 - Log[100, (32.6/101.06)^2]*5 == -0.333192

Initially non-flat space-time makes dark matter obsolete$dots$

I think there a few problems with this idea.

First off, as Stan Liou indicates, the early universe expanded extremely rapidly, potentially through hyper-inflation during the inflationary epoch. While we're still looking for observational evidence that this period occurred (e.g., the failed BICEP2 results a few years ago), the existence of such an epoch early in the universe neatly explains away several problems with the standard Big Bang theory (see the horizon problem, monopole problem, and the flatness problem). Assuming such a period existed, then any region of space-time that was "crumpled" would have been quickly and cleanly smoothed out during the hyper-inflation. Such crumpled-ness would not have been around long enough to affect cluster growth and structure. What's more, we very clearly measure that the Universe is flat over large, cosmic scales so it seems unlikely that there are constant and pervasive wrinkles as you suggest there could be.

A second issue I potentially see with your proposal is that it would imply a top-down approach to galaxy formation. That is, first you get huge clusters of mass (conglomerated by your "crumpled" space-time), then you get fragmentation and individual galaxies can form, then galaxies fragment into individual stars, etc. In other words, big structures form first, then smaller structures derive from the bigger structures. The opposite formation model would be "bottom-up" formation where first small things clump, then those clump into larger bodies and soon you have galaxies clumping into clusters. I don't think there is definitive evidence that galaxy formation is either top-down or bottom-up, but simulations seem to me to suggest bottom-up is more likely (of course those simulations use dark matter). I'll leave you to think about that one.

The last point of contention I have is that dark matter plays more of a role than just providing extra gravity. It contributes to the total mass-energy of the universe. Current theoretical models perform extremely well when we include dark matter. I believe a strong piece of evidence for this fact is our ability to theoretically match the CMB power spectrum using a Lambda-CDM model. I don't see that crumpled space-time could reproduce this result nearly as well.

I think also you'd have a very very hard time describing a mechanism that could allow "crumpling" to exist in the space-time of our universe which exactly matches the observed gravitational effects in galaxies. We can easily see that they appear to have a halo of matter which follows something akin to an NFW halo or else an Einasto profile. If you can find away that crumpled space-time would naturally form to match these profiles and somehow not be smoothed out by hyper-inflation, I'm all ears.

dna - What happens when cells in your body run out of telomeres?

During mitosis the genetic material in the cell is replicated to produce a copy of the genome for each resulting daughter cell. Due to the nature of the process, the ends of the chromosomes are not completely replicated, resulting in a slightly shorter copy of each chromosome after each round of replication.

Telomeres are extensions to the end of chromosomes that prevent damage or loss of genetic information during cell division. Telomeres are not replaced (in 'normal'/somatic cells), which gives rise to a replicative lifespan; the number of times a cell can divide before permenantly leaving the cell cycle (known as cellular senescence).

• This is generally viewed as an anti-cancer mechanism to protect against errors creeping in to the genome through many cell divisions. In order to become cancerous, a cell must first overcome its replicative lifespan [ref.]. This is achieved by activating the (normally inactive) telomerase enzyme that extends the telomeres - embryonic stem cells are one of the few cell types that normally express this enzyme, so they have unlimited replicative potential - a very important trait for stem cells.




• So a rapidly proliferating cell would indeed 'use up' it's telomeres before a different cell type. The cell would then either enter a state of senscence (permenant cell-cycle arrest), or apoptose. There are a lot of factors governing which outcome is realized, but the senscent cell population increases with age, and is proposed to contribute to many aging phenotypes (there is a recent fascinating study published in Nature where the authors remove all the senscent cells from aging mice, and the mice actually get healthier! Can't wait for studies that relate to human aging and senescent cell clearance (ref.)).

I have elaborated on the function of telomeres in the context of organismal aging in my answer to this question.

weather - What makes a really good observatory site, besides altitude?

• Not near an active or dormant volcano (but Mauna Kea seems to disprove this?). This is kinda a bummer because a lot of tall mountains seem to be volcanic.

There's nothing intrinsically wrong with dormant volcanos, as Mauna Kea and the observatories in the Canary Islands demonstrate. Not sure where you would have gotten that idea.

• Somewhere with clear and/or dry weather for as much of the year as possible

Clear weather is essential -- you can't observe when it's cloudy!

Dry weather is very good, especially for infrared observations (water vapor blocks a lot of infrared light).

• Not near major light pollution like cities

Yes.

• Cold weather is better than hot weather? Not sure I understand that; if it's uniformly hot or cold then I dont see how it makes a difference.

Cold climates tend to have drier air. (Antarctica is an extreme case.) Of course, being on top of a mountain means colder air, which is why Mauna Kea is good despite it's being in the tropics.

Am I missing any? Or are these wrong in some way?

You also want stable air with good "seeing", which rules out places with turbulent air and lots of wind (and is another reason mountaintops are good: they're usually above the most turbulent layers of the atmosphere).
Quoting from this page (which has a good discussion of the general topic):

Seeing ... requires at minimum a lack of extra turbulence at all atmospheric levels, and seems to be best satisfied in the convergence zones just outside the tropics, at latitudes about ± 30º. Also, minimal local turbulence is often associated with mountain peaks that reach into the otherwise undisturbed oceanic airflow, as on islands or coastal ranges (and given the direction of the planet's rotation, this generally favors western coast ranges).

Do boulders erode differently on asteroids than on the Moon?

If I understand it correctly, boulders on the Moon are only found near fresh craters, because micrometeorites erode them over time. Asteroids are believed to have formed sometimes even earlier than the Moon, but some images show asteroids covered by boulders. And NASA is planning the ARM mission to go pick up a boulder from an asteroid.

Are boulders more frequent on asteroids than on the Moon, and if so, by what kind of mechanism? For example, it is not primarily micrometeorites, but temperature changes that erodes them on the Moon. Or don't microgravity objects attract as many micrometeorites as the Moon does?

Intact boulders on asteroid 25143 Itokawa:

Eroded boulders on the Moon:

Does the quantity of dark matter needed in the Milky Way to give the stars their speed compare with the speed of the Milky Way?

Dark matter was needed to give the stars in a spiral galaxy a cause of their speed. So they proposed there must be some extra dark matter in the Galaxy. The total extra mass of dark mater is quite high. As a consequence of that, the whole galaxy becomes much heavier. But in the group or a cluster, the Galaxy also has a speed relative to other galaxies. So my question is whether the mass needed to give the stars their speed is the same mass that is needed to explain its movement within its cluster or a group?

spectroscopy - How do you estimate the error on the height/width of a Gaussian?

I'm trying to fit Gaussians to several lines in a spectrum that I have. Some of them overlap with one another, causing the fitting program that I'm using to not be able to give reasonable estimates for the errors on the measurements. For example, sometimes it will give the width of the spectral line to be 0.5 GHz but give the uncertainty at 1,000 GHz.

To fix this, I've been doing manual estimates on the ones that it can't get. I read that you can estimate the error on the peak of the Gaussian with:

Peak Error = (1/2)*(Width / Signal To Noise Ratio)

but I can't find anything for the height or width. Are there similar ways to estimate the uncertainty on these measurements?

Thank you.

human biology - Do probiotics survive digestion?

Apparently, some do and some don't.

I just tried searching for yogurt lactobacillus survival on Google, and the first hit I got was an article titled "Survival of yogurt-containing organisms and Lactobacillus gasseri (ADH) and their effect on bacterial enzyme activity in the gastrointestinal tract of healthy and hypochlorhydric elderly subjects" by Pedrosa et al. (1995), published in the American Journal of Clinical Nutrition, vol. 61, pp. 353–359. The abstract reads:

"The effect of the live bacterial yogurt cultures, namely Streptococcus thermophilus and Lactobacillus bulgaricus, and a mucosal adhering strain of Lactobacillus gasseri (ADH) on small intestinal and fecal bacterial characteristics was examined in 10 elderly subjects with atrophic gastritis and 23 elderly normal volunteers (11 received yogurt and 12 received ADH). Neither S thermophilus nor L bulgaricus was recovered from the stomach or small intestine of subjects fed yogurt or pasteurized yogurt. ADH was recovered from gastric or small intestinal aspirates in three of four subjects and in the stools of four of five subjects diagnosed with atrophic gastritis. In 11 of 12 normal subjects, ADH was isolated from stools. There was a significant reduction in fecal bacterial enzyme activity in both normal volunteers and subjects with atrophic gastritis after being fed with viable ADH. Adherent strains of bacteria such as ADH are likely to survive passage through the gastrointestinal tract and thus have greater metabolic effects."

---

Here's another result from the same search, "Survival and therapeutic potential of probiotic organisms with
reference to Lactobacillus acidophilus and Bifidobacterium spp." (PDF) by Kailasapathy & Chin, Immunology and Cell Biology (2000) 78, 80–88, which says:

"Lactobacillus delbrueckii ssp. bulgaricus and S. thermophilus (yoghurt starter cultures) are not bile resistant and do not survive the passage through the intestinal tract [Gilliland, 1978]. However, L. acidophilus and B. bifidum incorporated into the yoghurt starter culture have the ability to establish themselves among the gut flora [Tamime & Robinson, 1985]."

but also points out that, for survival in the gastrointestinal tract to matter, the bacteria must first survive long enough to get there:

"Strains of bifidobacteria used in some commercial products neither survive gastric transit nor product acidity during storage [Varnam & Sutherland, 1994]. [...] Eight commercial yoghurt samples claiming to contain viable bifidobacteria, sold in London, were enumerated for the presence of this organism. Only five of the eight yoghurts tested contained viable bifidobacteria at > 10⁶ per mL, while the remaining three did not contain any bifidobacteria [Masuda et al., 1993]. Modler and Villa-Garcia [1993] reported that bifidobacteria do not survive in several yoghurt products in North America, due to highly acidic conditions. [...] It is considered misleading to describe probiotic yoghurt as having health promoting properties unless the minimum level of viable cells is present at the expiry date."

Can methylation from DNA get copied to RNA during transcription?

I don't believe anything should change in the majority of DNA->RNA transcription. DNA methylation typically occurs on the non-watson crick side of Cytosine so it shouldn't affect the base-pairing.

However, there are a few hypothetical situations that would result in alterations of the transcribed RNA. The sponatneous deamination of the 4' amine would convert the base into uracil. If there is an additional 5' methyl, the 5-methyluracil would be recognized as Thymine.

(edit) I've talked with several genomics folks about this topic and it turns out that M5Cytosine is very resistant to deamination due to the presence of the Methyl group. As a result, the instance that I have just described is actually very rare.

5mCytosine to Thymine deamination

The other situation would be to errors in DNA proofreading. Does the 5mCytosine affect the fidelity of RNA polymerase? I honestly don't know but it would be worth examining.

dna - Do somatic cells alter their own nucleotide sequence?

I'm assuming you mean, physically changing the DNA polymer.
The answer is yes. And how they do this depends upon which cells they are and what they are supposed to do. A partial list:

In multicellular animals, cells DNA 'ages' where the telomeres, sequences at the ends of the chromosomes, will be degrade and shorten. This relates to how many times the cells have divided and acts as a sort of clock for development and probably also ageing. Telomere degradation does not happen in all cells - the germline cells are not modified of course. This is one of the probable reasons that cloning animals sometimes doesn't make perfect copies.

Cells will also add Methyl groups to the DNA nucleotides. Methylation is triggered when environmental or developmental conditions. The textbook example for methylation is the markers on the DNA of children whose parents have experienced starvation conditions. Methylation can disappear in subsequent generations. It also happens to cells in the brain which mark different stages in their brain development.

Meiosis, When sexual mating happens, the cells that make the sperm and eggs shuffle the pairs of chromosomes, editing so that about half of the resulting single set of chromosomes contain half of each parent's chromosomes.

Then, there is DNA repair. When radiation or chemicals breaks the chromosome, there are enzymes that repair them. Usually they read the opposite strand of the DNA to see how the repair happens. Sometimes the DNA is not reparable from the strand, and the result is not the same as the DNA the cell started with.

Short repeat DNA seem to show up in chromosomes - segments of short repeats can change length (AGGAGGAGGAGGAGT -> AGGAGGAGGAGGAGGAGGAGTAGGAGG etc). I'm not sure how this happens, but its different between identical twins. It also probably happens to cells in different parts of your body.

What else have I forgotten everyone?

There are also enzymes that coil the DNA up onto nucleosomes, but don't really make any changes, but we won't count that.

physiology - What happens to a human body once a sugary snack is consumed?

The human/animal digestive tract breaks down food chemically (with low pH/acid), enzymatically (like proteases and glycolytic enaymes which break down protein and sugars respectively), as well as symbiotically (bacteria participates in the breakdown of some compounds in the gut). The results are released into the blood stream for the most of the body to assimilate.

With foods with complex carbohydrates (scenario 1), the results can be only a modest change in the glucose level in the serum. This depends upon the specific food which you can understand better by researching the 'glycemic index'. Highly glycemic foods result in rather short term release of simple carbohydrates glucose/sucrose into the blood. Lower glycimic food contain complex carbohydrates (which are elaborate chains of sugars) which need to be broken up into simple carbohydrates before they are metabolized the the cells.

Foods which contain a lot of simple carbohydrates change the sugar levels in the blood nearly immediately and it can go quite high. simple carbohydrates are monomers or dimers of sugars. BTW complex carbohydrates have few pictures on the web, but you can imagine them as chains and networks of many many simple carbohydrates linked together.

Not all simple carbohydrates are used by human beings for energy. For instance the glycosamine in 'joint juice' is the sort that makes cartilidge, which just to show you how different some complex carbohydrates can be. BTW i don't recommend joint juice, just trying to give a familiar example. Its unlikely that the glucosamine you drink will be directly used for your joints!

So glucose is the energy currency in the blood. when the glucose level goes up insulin is secreted by the pancreas which tells the cells to take up the glucose for glycogen (internal cell energy storage in a complex carbohydrate) or to be metabolized directly. Diabetes results when insulin is not produced (type I) or when the cells stop responding to insulin (type II).

Human tolerance to glucose in the blood is estimated to be up to about 100 mg/dl long term. higher than this on the average is not healthy and can go up to several hundreds and cause lots of degeneration in the kidney, liver, and eyes, and more. Exercise and fasting increase insulin sensitivity and athletes have blood glucose that is quite low even if they have a sugary beverage.

hope this helps - many keywords embedded within...

One last note. Fructose, which is about 45-60% of high fructose corn syrup (the rest is sucrose) is almost entirely metabolized in the liver. This is why fructose can be harmful to people who drink too much sweetened beverages. With the liver taking in the vast majority of fructose, it tends to make fat out of it, sort of overdosing it to make it fatter than the rest of you relatively quickly. Fatty liver is a marginally disfunctional liver and can cause health problems down the way. Abdominal body fat (not on your love handles, but amongst your chest cavity and internal organs) is particularly harmful as it interferes with all sorts of organ function. Probably something everyone should be aware of.

lab techniques - What type of CCD system is required to take photos of luciferase

I'm working with luciferase and I want to be able to take a photo of it. The trouble is, I can see the luciferase glowing in all of its glory in front of me but no matter how hard I try, I can't take a photo of the luciferase with my DSLR (Nikon D80).

I'm curious if I'm missing a certain lens or if I should be shooting using a different lighting setup. I'm already exposing for 30". Perhaps longer?

homework - Substrates of cytochemical reactions in this immunostaining

Expression of extracellular protein Laminin 9 alpha-4 chain in human skeletal muscle.
Indirect immunostaining with HRP immunostain marker. Ob.x40.

I have unsuccessfully searched NCBI -database, JSTOR and other major Biology databases for an answer. This suggests to me that I do not understand what is going on.

1. What are the substrates of above cytochemical reactions for the given immunostaining above?

---

I need to give a simpler question where I apparently know the reaction exactly, since it is possible that people cannot answer the above question.

Mitochondria in Hep-2 cell line cells. Cytochemical test for mitochondria specific enzyme NAHD dehydrogenase. Ob.x40.

2. What is the substrate of the cytochemical reaction?

My answer:

The reaction of NADH dehydrogenase is:

NADH + H⁺ + CoQ → NAD⁺ + CoQH₂

Substrate: CoQ

genetics - Number of beneficial mutations cataloged?

That would be hard to say because really beneficial mutations become well distributed through the genome. Basically the differences between us and chimpanzees are a catalog of all the beneficial (or completely neutral) mutations since the ~4.7 M years since we diverged from each other.

Separating them from changes which have no special effect would be difficult too, but more to the spirit of your question, its difficult to explain what many mutations do, unless they cause significant changes in something we can observe in the individual (like height, weight, big nasty claws, etc).

For some more specific examples you can look at Online Mendelian Inheritance in Man. Some mutations which are useful sometimes might be related to skin color for instance (really helps when there is a lot of sun about) or lactose tolerance (a variation which is popular amongst europeans who have been drinking dairy milk for thousands of years).